Гипертрофия мышц в ответ на различные режимы мышечного сокращения

Изучалось влияние различных режимов мышечного сокращения на гипертрофию  мышц.  Исследования проводили на  крысах. Все три  тренировочных режима привели к одинаковому увеличению общей ДНК и РНК мышц. Изометрический и концентрический тренировочные режимы, в отличие от эксцентрического привели к увеличению инсулиноподобного фактора роста и уровня мРНК.

 

В книге А.В.Самсоновой Гипертрофия скелетных мышц человека влиянию различных режимов сокращения мышц на увеличение объема скелетных мышц посвящен отдельный параграф.

 

Adams, Gregory R., Daniel C. Cheng, Fadia Haddad, and Kenneth M. Baldwin. Skeletal muscle hypertrophy in response to isometric, lengthening, and shortening training bouts of equivalent duration. J Appl Physiol 96: 1613–1618, 2004;

Department of Physiology and Biophysics, University of California, Irvine, California 92697

 

Адамс Г.Р.

ГИПЕРТРОФИЯ СКЕЛЕТНЫХ МЫШЦ В ОТВЕТ НА ИЗОМЕТРИЧЕСКИЙ, ЭКСЦЕНТРИЧЕСКИЙ И КОНЦЕНТРИЧЕСКИЙ РЕЖИМЫ ТРЕНИРОВКИ ОДИНАКОВОЙ ДЛИТЕЛЬНОСТИ

ABSTRACT

Движения, производимые при мышечном сокращении в основном включают периоды мышечного сокращения, удлинения, а также, усилия, развиваемые в отсутствии внешних изменений длины (изометрические). Однако, в отдельных случаях силовой тренировки, упражнения иногда преднамеренно подбираются так, чтобы подчеркнуть один из этих режимов.

Цель данного исследования состояла в том, чтобы объективно оценить относительную эффективность каждого тренировочного режима для вызова компенсаторной гипертрофии. На примере модели крысы с электрически стимулируемым сокращением седалищного нерва, использовались группы крыс, выполнивших 10 тренировочных сеансов в течение 20 дней. В пределах каждого тренировочного сеанса продолжительность стимуляции была одинаковой для каждого из трех режимов. Хотя этот протокол обеспечивал равную продолжительность циклов работы, суммарный момент силы для индивидуальных сокращений заметно различался в тренировочных режимах, таких как эксцентрический> изометрический> концентрический. Результаты указывают, что ответная гипертрофия не прослеживала связи суммарного момента силы с увеличением массы в изометрическом режиме на 14 %, в концентрическом режиме на 12 %, и в эксцентрическом на 11 %. Все три тренировочных режима привели к одинаковым увеличениям общей ДНК и РНК мышцы. Изометрический и концентрический тренировочные режимы, в отличие от эксцентрического привели к увеличению инсулиноподобного фактора роста и уровня мРНК.

Эти результаты указывают, что относительно чистый тренировочный режим упражнений дает в результате одинаковый уровень компенсаторной гипертрофии, который не обязательно прослеживает связь с общим количеством силы, произведенной во время каждого сокращения.

ВВЕДЕНИЕ

В ОТСУТСТВИИ ПАТОЛОГИЧЕСКИХ условий структурные и функциональные свойства скелетной мышцы в основном соответствуют текущему уровню требований отдельных мышц. В ответ на увеличение запроса, в случаях, связанных с изменениями в профессиональной или деятельности во время досуга, скелетная мышца может приспосабливаться через увеличение размера мышечного волокна и изменение в составе метаболически- и сократительно- выраженных белков. Диаметрально противоположные изменения могут также произойти при существенном уменьшении нагрузки (26).

Механизмы, содействующие функциональной адаптации скелетной мышцы, по всей видимости, находятся в основном в пределах самой мышцы. Это обстоятельство учитывается при специфической адаптации действующей мышцы.

Нагрузка скелетных мышц, являющаяся частью профессиональных и спортивных действий часто включает периоды нагрузочного сокращения и удлинения мышц, так же как периоды, во время которых мышцы активизированы, но никакие внешние изменения длины не происходят (изометрическая нагрузка). Относительный вклад этих трех режимов нагрузки в процессы, стимулирующих адаптацию мышцы, представляет большой интерес в области планирования силовой тренировки. Хорошо известно, что модели силовой тренировки, характеризующиеся достаточной интенсивностью, частотой и продолжительностью, могут вызвать адаптацию скелетной мышцы, включающую компенсационную гипертрофию (22).


Если Вас интересует гипертрофия мышц, рекомендую обратить внимание на мою книгу "Гипертрофия скелетных мышц человека"


Это также общепринято для программ, подчеркивающих один специфический тренировочный режим (например, эксцентрический, концентрический или изометрический). Методы тренировки, которые использовали относительно чистое сокращение, удлинение, или изометрическую нагрузку, продемонстрировали, что каждый из этих трех режимов нагрузки может стимулировать адаптацию мышцы, включая гипертрофию и увеличение силы (11, 13, 15, 18-21, 23, 24, 30, 33).

Различные исследования, которые сравнивали режимы, показали, что один режим может быть более эффективен, чем другой в стимулировании различных видов адаптации (11, 15-17, 19, 21, 23, 24, 28). Например, Komi и Buskirk (21) сообщили, что тренировка в эксцентрическом режиме привела к большему увеличению силы (проверялись все 3 режима), чем при концентрическом режиме. Напротив, группа Rutherford’s показала, что тренировки в эксцентрическом режиме (LMT) в основном привели к меньшему увеличению в силе и размере мышцы, чем в любом изометрическом режиме (IMT) (19, 27, 28) или в тренировках в концентрическом режиме (SMT) (19, 27, 28). Кроме того, исследования показали, что комбинированные тренировки, в которых применялся режим сокращение + удлинение, превосходили тренировки, использующие только SMT в отношении увеличения силы (например, 9). Анализируя различные экспериментальные исследования, важно отметить, что, в зависимости от модели эксперимента, абсолютная нагрузка, применяемая во время LMT, часто существенно больше, чем применяемая в SMT или IMT (16, 17, 19, 21). Например, в двух таких исследованиях, где выделялась эксцентрическая нагрузка, удлиняющие упражнения включали в себя силы, составляющие 145-166% от прилагаемых во время концентрической тренировки (19, 21). В противоположном эксперименте Mayhew и др. (23) сравнил SMT и LMT в одинаковой относительной мощности и нашел, что SMT привел к большей гипертрофии (волокон второго типа) и большему изометрическому увеличению силы.

Прямые сравнения влияния тренировочных режимов на адаптацию мышц проводились в основном на людях, чаще всего с использованием активации произвольно сокращающихся мышц. Произвольная силовая тренировка у людей осложняется такими факторами, как вероятность моторного обучения и тем самым нервной адаптации. Цель данного исследования состояла в том, чтобы сравнить модели тренировок, вовлекающие концентрическую, эксцентрическую или изометрическую нагрузку на примере модели крысы с использованием электрического возбуждения нерва, вызывающего активацию мышцы. Наша рабочая гипотеза была в том, что тренировочные режимы, которые вырабатывают относительно большие уровни силы, приведут к значительно большей гипертрофии. Вопреки этой гипотезе наши результаты показывают, что в течение равного периода максимальной активации с эквивалентными параметрами возбуждения ответная гипертрофия была похожей в каждом из этих режимов упражнений.

МЕТОДЫ

Животные

Это исследование проводилось в соответствии с Руководящими принципами APS Заботы о Животных(Guiding Principles in the Care and USE of Animals), протокол был одобрен Университетом Калифорнийского IACUC. Молодые взрослые крысы-самки Sprague-Dawley, весящие 252 ± 4 г, были произвольно разбиты на три группы (минимально 6 в группу): IMT, SMT, или LMT. Группы крыс были помещены в стандартные клетки вивария на 12-часовой свето-темновой цикл, им был разрешен свободный доступ к пище и воде.

Активация мышц. Для каждой тренировочной сессии крысам проводилось легкое обезболивание ketamine (30 мг/кг), xylazine (4 мг/кг), и acepromazine (1 мг/кг). Электроды возбуждения, состоящие из покрытого тефлоном провода из нержавеющей стали, вводились в подкожную область, смежную с подколенной ямкой через шприцы для подкожных инъекций 22 размера. В последствии иглы были вынуты, оставляя провод на месте. Перед вставкой электрода маленький участок тефлонового покрытия зачищался для оголения провода. Провода были размещены латерально и медиально по отношению к местоположению седалищного нерва, допуская полевое возбуждение нерва. Затем стимулирующие провода были присоединены к полюсам вывода изоляционного стимулирующего модуля Grass, связанного с помощью интерфейса с Grass-стимулятором S8. Это обеспечивало поставку потока к седалищному нерву, приводящему к сокращению мышцы. Крысы были помещены на специально сделанную учебную платформу, описанную ранее (6). Правая нога была установлена в педаль, прикрепленной к оси Cambridge model H эргометра. Напряжение и частота возбуждения (52 ± 0.8 Гц) были откорректированы, чтобы производить максимальную изометрическую напряженность. Предварительные исследования показали, что такой подход привел к воспроизводимому моменту силы в пределах одного животного и между крысами в ходе многократных тренировочных занятий.

Программы тренировок

Для всех серий упражнений параметры стимуляции составляли 1 с возбуждения через 20 с между возбуждениями, 5 стимуляций за серию. Четыре серии стимуляций проводились с 5 минутами восстановления между сериями. В каждом случае эта программа приводила к <20%-ой усталости (первая серия по сравнению с последней). После каждого тренировочного занятия электроды вынимались.

Тренировочные программы контролировались компьютером через цифро-аналоговую панель (модель DDA-06, Приборы Keithley), применявшуюся для управления отклонением педали и запускающую возбуждение. Отдельная аналого-цифровая панель (DAS-16) использовалась, чтобы обеспечить измерение силы (приобретение на 100 Гц). Сбор данных, управление запуском возбуждения, и отклонение педали были запрограммированы при использовании Портативного компьютера LabTech. Анализ данных проводился при использовании программного обеспечения AcqKnowledge (Biopac Systems). Вывод силы проверялся в режиме реального времени на экране компьютера во время каждого сокращения.

Крысы дрессировались в начале стандартного светового цикла через день в течение 20 дней (т.е. 10 тренировочных занятий). Для группы IMT крысы устанавливались правой ногой на педали под углом ~44 ° относительно голени. Во время возбуждения мышцы угол педали не изменялся. Для группы SMT эргометр позволил педали двигаться от 44 до 64 ° после начального развития максимальной изометрической напряженности. Для группы LMT эргометр позволил педали двигаться от 44 ° до 24 ° после развития максимальной изометрической напряженности. Для SMT и LMT режимов, 1-c стимуляция включала 0.3 c изометрического развития силы и 0.7 c движения. Частота движения в SMT и LMT режимах ограничивалась 29 °/c, для поддержания развития силы.

Сила и измерение момента силы

Система эргометра, используемая в этих исследованиях, допускает поворачивание центральной оси, которая также приспособлена для обнаружения момента силы. Степени движения для эксцентрического и концентрического режимов известны, поэтому работа может быть вычислена. Однако, изометрическое упражнение не включает в себя внешнюю работу (то есть, изменение длины), и поэтому работа не может быть вычислена. Поскольку момент силы был фактически аналогичным для каждого животного, данные для каждого режима упражнений представляют собой величину генерации силы. Чтобы иметь возможность проведения прямых сравнений между режимами, данные представлены в виде интеграла момента силы.

Сбор ткани

Спустя двадцать четыре часа после последней тренировки (день 20), крысы были уничтожены путем инъекции раствора для эвтаназии Pentosol (Медиана-Pharmex) в дозе 0.4 мл/кг ( ~160 мг/кг pentobarbitol натрий ip) (14). После прекращении сердцебиения был сделан разрез кожи, и интересующие мышцы ноги (передняя большеберцовая, подошвенная, камбаловидная, и медиальная икроножная) были по отдельности иссечены, взвешены и быстро заморожены для дальнейшего анализа.

Биохимические и молекулярные исследования

Образцы ткани были проанализированы на общее содержание белка как описано ранее (1). Миофибриллярное содержание белка определялось путем модификации метода, описанного ранее (29).

Полная изоляция РНК

Выделенная РНК была извлечена из предварительно взвешенных замороженных мышечных образцов с использованием реактива тримарана(TRI) (Молекулярный Исследовательский центр, Цинциннати, Огайо), согласно протоколу компании, который основан на методе, описанном Chomczynski и Sacchi (7). Извлеченная РНК осаждалась из водной фазы изопропиловым спиртом, промывалась этанолом, была высушена и переведена во взвешенное состояние в известном объеме воды без нуклеаз. Концентрация РНК определялась оптической плотностью в 260 нм (использование оптического модуля 260 нм плотности, эквивалентного 40 µg/ml). Концентрация РНК всех мышц вычислена на основе полного количества и веса РНК проанализированного образца. Образцы РНК сохранялись замороженными при -80°C, для дальнейшего использования в сравнительных процедурах RT-PCR.

RT(Обратная транскрипция). Один микрограмм общего количества РНК был обратно расшифрован для каждого образца мышц с использованием SuperScript II RT от GIBCO BRL и смеси олиго (dT) (100 нанограммы/реакции) и случайных праймеров (затравки) (200 нанограммов/реакции) в 20 µl объема реакционной смеси при 45°C в течение 50 минут, согласно предоставленному протоколу. В конце реакции RT пробирки оставались нагретыми до 90°C в течение 5 минут для остановки реакции и затем были сохранены в – 80°C до использования в реакциях PCR для специфического мРНК анализа (см. ниже).

PCR (ПЦР- полимеразная цепная реакция). Изучение проявления специфической мРНК для инсулиноподобного фактора роста I (IGF-I) и механо-фактора роста (MGF) проводилось при помощи сравнительного метода RT-PCR, применявшего 18S, как внутренний стандарт (Ambion, Остин, Техас). Последовательности праймеров, используемых для конкретных задач мРНК показаны в Таблице 1. Праймеры были приобретены в Life Technology, GIBCO.

В каждой реакции PCR 18S рибосомная РНК была коамплифицирована с целевой кДНК (мРНК), в качестве внутреннего стандарта, дающего возможность корректировать любые различия в исходном количестве полной РНК.

Таблица 1. Последовательность определенных наборов праймеров, которые использовались в RT-PCR мРНК исследованиях

Target mRNA

PCR Primer Sequence 5’ ->3’

Product Size, bp

GenBank Accession No.

IGF-I (all)

5' sense: GCATTGTGGATGAGTGTTGC

202 all

X06043

3' antisense: GGCTCCTCCTACATTCTGTA

254 MGF

MGF

5' sense: GCATTGTGGATGAGTGTTGC

163

X06108

Load-sensitive IGF-I

3' antisense: CTTTTCTTGTGTGTCGATAGG

IGF-I, инсулиноподобный фактор роста I; MGF, механический фактор роста

Для амплификации 18S мы использовали Alternate 18S Internal Standards (Ambion), собранный с 324-пар нуклеотидов продукта. Праймеры 18S были смешаны с компетимерами в оптимальном отношении, которое могло варьировать от 1:4 до 1:10, в зависимости от представленности целевого мРНК. Включение 18S компетимеров было необходимо, чтобы снизить сигнал 18S, позволяющий линейную амплификацию в том же самом диапазоне, как и коамплифицированный целевой мРНК (Relative RT-PCR kit protocol, Ambion).

Для каждого целевого мРНК RT и реакция PCR были выполнены при идентичных условиях с использованием того же самого премикса реактивов для всех образцов, сравниваемых в исследовании. Для подтверждения однородности процедур анализа, по крайней мере один представитель от каждой группы был включен в каждый выполненный RT-PCR.

Один микролитр каждой RT-реакции (0-к 10-разовому разбавлению, в зависимости от представленного целевого мРНК) использовался для амплификации PCR. Реакции PCR были выполнены в присутствии 2-миллилитров MgCl2 при использовании стандартного буфера PCR (GIBCO), 0.2 мм dNTP, 1 µM специфического набора праймеров, 0.5 µM соединения праймер-competimer 18S, и 0.75 модуля ДНК полимеразы Taq (GIBCO) в 25 µl полного объема. Амплификации были выполнены в Stratagene Robocycler с 3-х минутным начальным шагом денатурации при 96°C, с последующими 25 циклами в 1 минуту при 96°C, 1 минуты при 55°C (55-60°C в зависимости от праймеров), 1 минуты при 72°C, с заключительным 3-х минутным шагом при 72°C. Продукты PCR были разделены на 2-2.5 % агарозу-гель путем электрофореза и окрашены бромидом этидия, для определения количества сигнала проводилось лазерное сканирование денситометрия, как сообщалось ранее (31). При таком подходе каждый определенный сигнал мРНК был упорядочен к его соответствующему 18S. Для каждого набора праймеров условия PCR (кДНК разбавление, 18S competimer-праймер соединение, концентрация MgCl2, и температура ренатурации) были поставлены в оптимальные условия так, чтобы и целевой мРНК и выход 18S продукта были в линейном диапазоне графика в полулогарифмическом масштабе, когда выход продукта выражен как функция числа циклов (5).

Статистический анализ. Все значения оценивались средним арифметическим и стандартной ошибкой среднего (М± SE). Для каждой отметки времени тренировочный эффект определялся однофакторным дисперсионным анализом (ANOVA) с последующей проверкой с применением пакета программ Graphpad. Для анализа отношений между интегралом по времени момента силы и изменениями в мышечной массе использовался анализ корреляции Пирсона с использованием пакета Graphpad. Анализ непараметрических данных, таких как проценты, проводился с помощью критерия Краскера-Уоллиса, с последующим Dunn’s анализом (Graphpad). Для всех статистических тестов был принят статистический уровень значимости 0.05.

РЕЗУЛЬТАТЫ

Все три модели силовой тренировки привели к гипертрофии мышц. Относительно контрольных мышц, массы тренированных медиальных икроножных мышц увеличились на 14, 12, и 11 %, для IMT, SMT, и групп LMT, соответственно (рис. 1).

Гипертрофия мышц в ответ на различные режимы мышечного сокращения

Рис.1.Увеличенная мышечная масса, полученная в результате тренировки. IMT, изометрического режима, SMT концентрического режима, LMT, эксцентрического режима. Contra - контралатеральный нетренированная мышца; MG, медиальная икроножная. Значения - средства ± SE. *P <0.05 по отношению к контрольной мышце (Contra).

Для каждой группы концентрация количества общего и миофибриллярного белка в эксперименте и в контрольных медиальных икроножных мышцах не различались, показывая на то, что изменения в массе обуславливались ответной гипертрофией, а не какими-то другими факторами, такими, как отек (данные не указаны).

Ответная гипертрофия в тренируемых мышцах сопровождалась существенным увеличением ДНК и содержания полного РНК мышц, которое было похожим для всех трех экспериментальных режимов (рис. 2, A и B).

Гипертрофия мышц в ответ на различные режимы мышечного сокращенияРис.2. Увеличение содержания ДНК (A) и РНК (B), следующие из силовой тренировки. Значения - среднее ± SE. *P <0.05 против Contra.

Как сообщалось ранее, инсулиноподобный фактор роста-I (IGF-I) и чувствительная к нагрузке изоформа инсулиноподобного фактора роста MGF(механический фактор роста), отвечают на изменения в состоянии нагрузки (1, 2, 14). Мы использовали IGF-I и MGF мРНК, как маркеры ответа на молекулярном уровне, произведенных программами силовой тренировки. Тренировки в IMT и SMT режимах привели к существенным увеличениям выражения и/или накопления мРНК для IGF-I и MGF, изоформы IGF-I, чувствительного к нагрузке (32) (рис. 3). В LMT-режиме IGF-I и MGF мРНК значительно не увеличились ответ на тренировку (рис. 3).

Гипертрофия мышц в ответ на различные режимы мышечного сокращенияРис.3. Изменения в выражении и/или накоплении мРНК для механического фактора роста (MGF; A) или инсулиноподобного фактора роста I (IGF-I; B). *P <0.05 против Contra.

Как показатель относительного момента силы, произведенного во время каждой модели тренировки, вычислялся интеграл кривой момента силы для третьей стимуляции в каждом подходе. Для 10 тренировочных сеансов среднее значение этих интегралов значительно различалось для всех трех тренировочных режимов (рис. 4). Тренировка в LMT-режиме привела к интегралу момента силы, в 1.9-и 3 раза большему, чем в IMT и SMT-режимах соответственно (рис. 4).

Гипертрофия мышц в ответ на различные режимы мышечного сокращенияРис. 4. Производство момента силы во время функциональной электрической стимуляции, вызванной упражнениями на сопротивление. Наверху: стандартная запись кривой 1-s момента силы из набора данных, собранных во время проведения тренировки с сопротивлением. Для SMT позиция ноги двигалась от 44 до 64 ° и от 44 ° до 24 ° для LMT. Внизу: Среднее значение интеграла момента силы, вычисленный от всех тренировочных занятий для всех крыс, представленных тренировочным режимом. Значения - среднее ± SE. *Каждое среднее значение интеграла момента силы значительно отличается от других, P <0.05.

Средний интеграл момента силы группы IMT был в 1.6-раза больше, чем он же в группе SMT (рис. 4). Подобные же результаты были отмечены, если анализировались суммарные значения момента силы (данные не указаны).

Гипертрофия мышц в ответ на различные режимы мышечного сокращенияРис. 5. Не было никаких видимых связей между изменением в массе мышц и средним интегралом момента силы после силовой тренировки.

Не обнаружено корреляции между вызванными тренировкой изменениями в мышечной массе (например, тренированная минус контрольная масса) и средним значением интеграла момента силы для всех мышц в эксперименте (рис. 5).

ОБСУЖДЕНИЕ

Относительная эффективность LMT, SMT, или IMT привлекала интерес достаточно давно (например, 8). Очевидно, что каждый учебный режим может вызывать мышечную адаптацию. Однако, результаты многочисленных исследований, проводимых на людях, часто приводили к некоторой путанице относительно эффективности IST,SMT, или LMT. Это особенно справедливо относительно изменений в силе. В этом случае путаница частично связана с применяемыми видами тестирования, в связи с тем, что воздействие индивидуального тренировочного режима обнаруживает некоторую специфику в отношении проведения эксперимента в этом же режиме.

Мышечная масса, возможно, самый важный определяющий фактор функциональных способностей и в силу этого привлекающая большое внимание в профессиональной и клинической /td/emпрактике. Упражнения с отягощениями или упражнения с сопротивлением являются преимущественными методами поддержания, увеличения, или восстановления мышечной массы. Это может быть особенно важным в случаях, когда есть риск атрофии мышц, к примеру, при постельном режиме или в космическом полете. Темой данного исследования была относительная эффективность IMT, SMT, и LMT в стимулировании ответной гипертрофии.

Хотя существуют многочисленные исследования тренировки с сопротивлением на человеке, включавшие надежные измерения изменений в мышцах - или размеров мышечного волокна, немногие из этих исследований также включали систематические сравнения относительных воздействий тренировочного режима на компенсационную ответную гипертрофию. В результате мы знаем, что IMT, SMT, или LMT могут стимулировать гипертрофию мышц, но совсем мало известно об относительной эффективности каждого режима в стимулировании этого ответа.

Что касается исследований на животных и упражнений с сопротивлением, результаты, найденные в литературе в основном выполнены на моделях, при которых не может быть определен количественно режим нагрузки и/или сокращения мышц или групп мышц (например, Refs. 2, 3, 10). Методы, используемые в настоящем исследовании, представляют попытку преодолеть этот недостаток. Единственный недостаток данного исследования - то, что зарегистрированная выводимая сила была итогом активации всех мышц, лежащих ниже точки стимуляции нерва. Для каждого тренировочного режима 10 учебных сеансов, проведенных в этом исследовании, не оказали никакого значительного эффекта на изменение массы камбаловидной и передней большеберцовой мышц и минимальное влияние на подошвенную (данные не указаны). Поэтому, мы предположили, что большая часть силы, измеренная во время стимуляции, производится икроножной мышцей. У крысы икроножная мышца составляет 75-80 % массы мышц задней поверхности ноги (например, triceps surae плюс plantaris), тогда как медиальная головка икроножной мышцы составляет ~40 % этой общей мышечной массы. Таким образом, мы полагаем, что изменения, замеченные в медиальных икроножных мышцах, способны отразить воздействие программы силовой тренировки.

В свете существенного различия в интегралах момента силы для трех тренировочных режимов (рис. 4) может казаться несколько удивительным, что большая часть анаболических эффектов была очень похожа. Например, относительные изменения, замеченные в ДНК и РНК, не были различны для этих трех режимов (рис. 2 и данные не указаны). Однако, на молекулярном уровне было небольшое расхождение в результатах, измеренных в медиальной икроножной мышце. Например, мРНК для двух изоформ IGF-I значительно вырос после IMT и SMT, но эти изменения не были значимыми в мышцах при LMT (рис. 3). При непосредственном исследовании (например, в отдельном подходе), Bamman и др. (4) нашел, что удлиняющие, но не сокращающие упражнения привели к существенному увеличению IGF-I мРНК в мышце (4). Однако, не ясно, существуют ли противоречия между результатами Bammen и др. и настоящим исследованием, поскольку наши данные были собраны после 10 тренировок.

Изложенные нами результаты указывают, что стимулы, управляющие адаптацией в скелетных мышцах в использованной модели эксперимента, вероятно не стехиометрически связаны с суммарной работой или общим усилием, полученных в ходе тренировочного процесса. Этот вывод может также быть сделан на основе данных, представленных многими исследователями, включая Смита и Rutherford, который сообщил, что величина мышечной силы, полученная во время тренировки, не была количественно связана с величиной адаптационной гипертрофии у людей (16, 23, 28). В ряде дополнительных статей Rutherford с коллегами (27, 28) предположили, что адаптация может быть функцией метаболической нагрузки, вызванной тренировочной активностью. Результаты настоящего исследования не поддерживают сторонников этой метаболической гипотезы (большая метаболическая нагрузка с SMT против LMT), здесь LMT и SMT привели к эквивалентным изменениям величины гипертрофии мышц у крыс. Многие дополнительные исследования на людях также указали, что отношения между метаболической и мышечной нагрузкой, по всей видимости, не являются основным определяющим показателем адаптации (например, Refs. 12, 30).

Характерным аспенемногие из этих исследований также включали систематические сравнения относительных воздействий тренировочного режима на компенсационную ответную гипертрофию. В результате мы знаем, что IMT, SMT, или LMT могут стимулировать гипертрофию мышц, но совсем мало известно об относительной эффективности каждого режима в стимулировании этого ответа. ктом организации нашего эксперимента в тренировке крыс было то, что мы включили период изометрического развития силы перед движением в обоих режимах SMT И LMT (см. МЕТОДЫ и рис. 4, верх). Возможно, что изометрическое развитие силы оказало существенное влияние на адаптационный процесс динамического эксперимента. Трудно понять, присутствовал ли подобный изометрический компонент в большинстве ранее опубликованных работ, сравнивающих тренировочные режимы у человека. Однако, хотя это явно не показано, можно предположить, что, в зависимости от методов тренировки (например, изокинетический против постоянного внешнего сопротивления), изометрические компоненты существуют в некоторых схемах протоколов для тестирования динамических движений. Например, в исследовании эксцентрической тренировки, проведенном Housh и др. (18), авторы указывают, что испытуемые отмечали, что они имели «контроль над нагрузкой» перед полным отпусканием и движением. Это предполагает, что испытуемые выполняли некоторую часть нагрузки изометрически перед инициированием эксцентричного действия. Кажется весьма вероятным, что механические ограничения (например, неспособность мгновенно начать движение когда мышцы активизированы и/или при требовании преодолеть инерцию) в большинстве методов потребовалось бы, чтобы испытуемые развили существенный, как бы переходный, уровень изометрической силы в большинстве тренировочных ситуаций.

В заключении можно сказать, что используя метод, который не должен включать какое-либо моторное обучение, мы нашли, что тренировка с сопротивлением с одинаковыми параметрами активации в изометрическом, концентрическом, или эксцентрическом режимах привела к практически эквивалентным уровням гипертрофии мышц. В пределах этих тренировочных занятий суммарный момент силы значительно изменился таким образом, что LMT> IMT> SMT. Эти результаты подтверждают предыдущие исследования, которые показали, что величина работы, произведенная во время силовой тренировки прямо не соотносится с адаптационными процессами в скелетной мускулатуре

ГРАНТЫ

Это исследование было поддержано National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-45594 (to G. R. Adams) и Национальным Космическим Биомедицинским Грант Научно-исследовательского института NCC9-58 (к K. М Болдуина). D. Cheng был поддержан частичным вознаграждением от University of California Irvine Undergraduate Research Opportunity Program.

ПОДТВЕРЖДЕНИЯ

Авторы благодарят Sam McCue, Paul Bodell, Ming Zeng, and Li-Ying Zhang за техническую помощь.

СНОСКИ

Адрес для перепечатки и другой корреспонденции: G. R. Adams, University of California Irvine, Dept. of Physiology and Biophysics, 335-D Medical Sciences 1, Irvine, CA 92697-4560 (E-mail: GRAdams@uci.edu.

Затраты для публикации этой статьи были частично оплачены размером стоимости страницы. Статья должна поэтому быть тем самым отмечена, как «рекламная» в соответствии с 18 U.S.C. Section 1734 исключительно, чтобы указать этот факт.

ЛИТЕРАТУРА

  1. Adams GR and Haddad F. The relationships between IGF-1, DNA content, and protein accumulation during skeletal muscle hypertrophy. J Appl Physiol 81: 2509-2516, 1996.[Abstract/Free Full Text]
  2. Adams GR, Haddad F, and Baldwin KM. Time course of changes in markers of myogenesis in overloaded rat skeletal muscles. J Appl Physiol 87: 1705-1712, 1999.[Abstract/Free Full Text]
  3. Baar K and Esser K. Phosphorylation of p70(S6k) correlates with increased skeletal muscle mass following resistance exercise. Am J Physiol Cell Physiol 276: C120-C127, 1999.[Abstract/Free Full Text]
  4. Bamman MM, Shipp JR, Jiang J, Gower BA, Hunter GR, Goodman A, McLafferty CL, and Urban RJ. Mechanical load increases muscle IGF-I and androgen receptor mRNA concentrations in humans. Am J Physiol Endocrinol Metab 280: E383-E390, 2001.[Abstract/Free Full Text]
  5. Bickel CS, Slade JM, Haddad F, Adams GR, and Dudley GA. Acute molecular responses of skeletal muscle to resistance exercise in able-bodied and spinal cord-injured subjects. J Appl Physiol 94: 2255-2262, 2003.[Abstract/Free Full Text]
  6. Caiozzo VJ, Ma E, McCue SA, Smith E, Herrick RE, and Baldwin KM. A new animal model for modulating myosin expression by altered mechanical activity. J Appl Physiol 73: 1432-1440, 1992.[Abstract/Free Full Text]
  7. Chomczynski P and Sacchi N. Single step method of RNA isolation by acid guanidimium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987.[Web of Science][Medline]
  8. Clarke DH. Adaptations in strength and muscular endurance resulting from exercise. Exerc Sport Sci Rev 1: 74-102, 1973.
  9. Colliander EB and Tesch PA. Effects of eccentric and concentric muscle actions in resistance training. Acta Physiol Scand 140: 31-39, 1990.[Web of Science][Medline]
  10. Deschenes MR, Judelson DA, Kraemer WJ, Meskaitis VJ, Volek JS, Nindl BC, Harman FS, and Deaver DR. Effects of resistance training on neuromuscular junction morphology. Muscle Nerve 23: 1576-1581, 2000.[CrossRef][Web of Science][Medline]
  11. Dudley GA, Tesch PA, Miller BJ, and Buchanan P. Importance of eccentric actions in performance adaptations to resistance training. Aviat Space Environ Med 62: 543-550, 1991.[Medline]
  12. Folland JP, Irish CS, Roberts JC, Tarr JE, and Jones DA. Fatigue is not a necessary stimulus for strength gains during resistance training. Br J Sports Med 36: 370-373, 2002.[Abstract/Free Full Text]
  13. Garfinkel S and Cafarelli E. Relative changes in maximal force, EMG, and muscle cross-sectional area after isometric training. Med Sci Sports Exerc 24: 1220-1227, 1992.[Web of Science][Medline]
  14. Haddad F and Adams GR. Acute cellular and molecular responses to resistance exercise. J Appl Physiol 93: 394-403, 2002.[Abstract/Free Full Text]
  15. Hather BM, Tesch PA, Buchanan P, and Dudley GA. Influence of eccentric actions on skeletal muscle adaptations to resistance training. Acta Physiol Scand 143: 177-185, 1991.[Web of Science][Medline]
  16. Higbie EJ, Cureton KJ, Warren GL 3rd, and Prior BM. Effects of concentric and eccentric training on muscle strength, cross-sectional area, and neural activation. J Appl Physiol 81: 2173-2181, 1996.[Abstract/Free Full Text]
  17. Hortobagyi T, Hill JP, Houmard JA, Fraser DD, Lambert NJ, and Israel RG. Adaptive responses to muscle lengthening and shortening in humans. J Appl Physiol 80: 765-772, 1996.[Abstract/Free Full Text]
  18. Housh TJ, Housh DJ, Weir JP, and Weir LL. Effects of eccentric-only resistance training and detraining. Int J Sports Med 17: 145-148, 1995.
  19. Jones DA and Rutherford OM. Human muscle strength training: the effects of three different regimes and the nature of the resultant changes. J Physiol 391: 1-11, 1987.[Abstract/Free Full Text]
  20. Kanehisa H, Nagareda H, Kawakami Y, Akima H, Masani K, Kouzaki M, and Fukunaga T. Effects of equivolume isometric training programs comprising medium or high resistance on muscle size and strength. Eur J Appl Physiol 87: 112-119, 2002.[CrossRef][Web of Science][Medline]
  21. Komi PV and Buskirk ER. Effect of eccentric and concentric muscle conditioning on tension and electrical activity in human muscle. Ergonomics 15: 417-434, 1972.[Medline]
  22. Kraemer WJ, Adams K, Cafarelli E, Dudley GA, Dooly C, Feigenbaum MS, Fleck SJ, Franklin B, Fry AC, Hoffman JR, Newton RU, Potteiger J, Stone MH, Ratamess NA, and Triplett-McBride T. American College of Sports Medicine position stand. Progression models in resistance training for healthy adults. Med Sci Sports Exerc 34: 364-380, 2002.[CrossRef][Web of Science][Medline]
  23. Mayhew TP, Rothstein JM, Finucane SD, and Lamb RL. Muscular adaptation to concentric and eccentric exercise at equal power levels. Med Sci Sports Exerc 27: 868-873, 1995.[Web of Science][Medline]
  24. Morissey MC, Harman EA, and Johnson MJ. Resistance training modes: specificity and effectiveness. Med Sci Sports Exerc 27: 648-660, 1995.[Web of Science][Medline]
  25. Peterson RT and Schreiber SL. Translation control: connecting mitogens and the ribosome. Curr Biol 8: R248-R250, 1998.[CrossRef][Web of Science][Medline]
  26. Roy RR, Baldwin KM, and Edgerton VR. The plasticity of skeletal muscle: effects of neuromuscular activity. Exerc Sport Sci Rev 19: 269-312, 1991.[Medline]
  27. Schott J, McCully K, and Rutherford OM. The role of metabolites in strength training. II. Short versus long isometric contractions. Eur J Appl Physiol 71: 337-341, 1995.
  28. Smith RC and Rutherford OM. The role of metabolites in strength training. I. A comparison of eccentric and concentric contractions. Eur J Appl Physiol 71: 332-336, 1995.[CrossRef][Web of Science]
  29. Thomason DB, Herrick RE, and Baldwin KM. Activity influences on soleus muscle myosin during rodent hindlimb suspension. J Appl Physiol 63: 138-144, 1987.[Abstract/Free Full Text]
  30. Welsh L and Rutherford OM. Effects of isometric strength training on quadriceps muscle properties in over 55 year olds. Eur J Appl Physiol 72: 219-223, 1996.[CrossRef]
  31. Wright C, Haddad F, Qin A, and Baldwin KM. Analysis of myosin heavy chain mRNA expression by RT-PCR. J Appl Physiol 83: 1389-1396, 1997.[Abstract/Free Full Text]
  32. Yang S, Alnaqeeb M, Simpson H, and Goldspink G. Cloning and characterization of an IGF-1 isoform expressed in skeletal muscle subjected to stretch. J Muscle Res Cell Motil 17: 487-495, 1996.[CrossRef][Web of Science][Medline]
  33. Young A, Stokes M, Round JM, and Edwards RHT. The effect of high-resistance training on strength and cross-sectional area of the human quadriceps. Eur J Clin Invest 13: 11-417, 1983.

Перевод А.В. Самсоновой

2004_Adams-et-al_Перевод.pdf